circad | circRNAs associated with diseases

circ-BANP
Gene	BANP	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	28103507
Experimental Method
Sample Type	Tissues	Comparison	Colorectal Cancer (CRC) cancerous and adjacent normal tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGGACGGTCAGCGTCGT Reverse GGCACAGCGTTGCTAATGAC	Statistics	Fold Change : Upregulated,>25.9-fold pvalue : p=0.037
Citation
Zhu, M, Xu, Y, Chen, Y, Yan, F (2017). Circular BANP, an upregulated circular RNA that modulates cell proliferation in colorectal cancer. Biomed. Pharmacother., 88:138-144.